rs2150624 chr9:94014327 T>C
- Sequence
agtctgaaatctcacttttgcctt[T/C]tccacttagaatatcctttttctt
- ASB in cell types
- foreskin keratinocyte HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.03 | 2.83 | |||
| HEK293 (embryonic kidney) | 1.59 | 0.39 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, obesity with early age of onset (age >2), prop taste detection threshold, schizophrenia