rs2150720 chr9:2469742 A>G
- Sequence
gtgaacagcctgagggttgtgaac[A/G]tccgggtgtcatgacacttttcta
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) THP-1 (acute monocytic leukemia) GM19239 (male B-cells lymphoblastoid cell line) GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -1.13 | 2.71 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | 0.24 | 0.96 | 1.99 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 1.29 | -0.03 | 1.50 | |||
| GM17942 (lymphoblastoid cell) | 1.18 | -2.86 | 1.50 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder in alcoholics, homa-ir, irritible bowel syndrome, ldl cholesterol, triglycerides