rs2151272 chr9:127186492 C>T
- Sequence
cttgccagccacccagctcacaag[C/T]ggtcccagaagacacgtgtccctg
- ASB in cell types
- HeLa (cervical adenocarcinoma)
- ASB for transcription factors
- INT11_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| INT11_HUMAN | 2.20 | -1.26 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, body mass index (bmi), eye color, fasting insulin, hip bone mineral density (bmd), homa-b, homa-ir, ldl cholesterol, partial epilepsy
GTEx eQTL Brain_Cerebellum, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood