rs2151389 chr20:46843685 C>T
- Sequence
aaaaacatggccagatcctgtgca[C/T]ggcagaatctgtaaaaacagtgga
- ASB in cell types
- MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant) | -1.34 | 2.38 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), arthritis including non-rheumatoid, hdl cholesterol, longstanding arthritis, rheumatoid arthritis, tetrology of fallot