rs2151654 chr1:11785467 G>A
- Sequence
aatcagcttgattcagccggtggt[G/A]gcagcatggctggatgcctcccca
- ASB in cell types
- stem and progenitor cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| stem and progenitor cells | 2.35 | -1.88 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood