rs2151763 chr14:63841129 G>T
- Sequence
tagaatctaggggcttagaggggg[G/T]gccccaagtggctgtgctcagtcc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.55 | 1.02 | 1.30 | -2.35 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
