rs2151953 chr10:94439475 A>T
- Sequence
ggcaggaagcctttggtggagtca[A/T]tttttttgttgagcaggctgcagg
- ASB in cell types
- PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PANC1 (pancreatic ductal adenocarcinoma) | -1.17 | 1.69 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid