rs2152475 chr10:72538934 A>G
- Sequence
atttggaaatagaaaccaaaagag[A/G]gcaggagtagctatacccagataa
- ASB in cell types
- GM02630 (Fanconi anemi)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | n/a | 2.84 | 1.00 | 3.70 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg