rs215302 chr7:83583948 G>A
- Sequence
gaaagaacttgagtcctcattgac[G/A]ttgttgagcctacacagctatgtg
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
- ASB for transcription factors
- SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 1.24 | -0.84 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, aortic valve calcium, bipolar disorder, crohns disease, combined control dataset, irritible bowel syndrome, neuroticism
GTEx eQTL Adipose_Subcutaneous, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid