rs2153960 chr6:108666981 G>A
- Sequence
gaattcaaagctgtaaaaacttga[G/A]ccttgtttaaccctctgccatgat
- ASB in cell types
- iPS-derived chondrocytes
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 0.01 | 1.22 | 2.00 | 3.36 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP asthma, body mass index (bmi), circulating igf-i concentrations, cystatin c in serum, hdl cholesterol, height, infant head circumference, intracranial volume, obesity with early age of onset (age >2), salmonella-induced pyroptosis, serum creatinine, systolic blood pressure (sbp)
PheWAS abnormal chest sounds, abnormal findings on mammogram or breast exam, abnormal mammogram, abnormal results of function study of liver, acute posthemorrhagic anemia, alzheimers disease, aneurysm of other specified artery, anomalies of jaw size/symmetry, antisocial/borderline personality disorder, aseptic necrosis of bone, atrial fibrillation, av block, benign mammary dysplasias, blood in stool, blood vessel replaced, cancer of other male genital organs, cardiac pacemaker in situ, cardiac pacemaker/device in situ, cholelithiasis with acute cholecystitis, chronic ischemic heart disease, coagulation defects, coronary atherosclerosis, cystic mastopathy, delirium dementia and amnestic disorders, delirium due to conditions classified elsewhere, dementias, disease of capillaries, disorders of lipoid metabolism, disorders of liver, disorders of menstruation, disorders of uterus, nec, disturbances in tooth eruption, diverticulosis, diverticulosis and diverticulitis, dysthymic disorder, enthesopathy, excessive or frequent menstruation, fracture of clavicle or scapula, functional digestive disorders, gastrointestinal hemorrhage, hemorrhage of rectum and anus, hemorrhagic disorder due to intrinsic circulating anticoagulants, hemorrhoids, herpes zoster, hyperbilirubinemia, hypercholesterolemia, hyperlipidemia, hyperosmolality and/or hypernatremia, inflammatory and toxic neuropathy, ingrowing nail, iron deficiency anemias, jaundice, kyphosis (acquired), labyrinthitis, lesions of stomach and duodenum, lipoprotein disorders, lyme disease, mechanical complication due to other implant and internal device, memory loss, mental disorders due to brain damage, myalgia and myositis nos, nephritis, nephrosis, renal sclerosis, osteoarthritis, localized, other diseases of lung, other disorders of eyelids, other disorders of lipoid metabolism and hyperalimentation, other disorders of prostate, other specified nonpsychotic and/or transient mental disorders, other specified osteoporosis, ovarian cyst, peptic ulcer, peptic ulcers, persistent mental disorders due to other conditions, pervasive developmental disorders, poisoning by other anti-infectives, poisoning by psychotropic agents, postinflammatory pulmonary fibrosis, postmenopausal atrophic vaginitis, ptosis of eyelid, pulmonary heart disease, pyogenic arthritis, respiratory complications, second degree av block, secondary malignancy of lung, senile dementia, skin neoplasm of uncertain behavior, suicidal ideation or attempt, sulfonamides, supraventricular premature beats, systemic sclerosis, ulcerative stomatitis & mucositis, unstable angina (intermediate coronary syndrome)
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Colon_Transverse, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid