rs2156444 chr11:123304872 C>G
- Sequence
atcacgtttgcttaagattgacca[C/G]ttttcctgccacaggaaggaaaaa
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -2.02 | 2.42 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -1.82 | 2.33 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), birth weight, mitral annular calcium, refractive error, salmonella-induced pyroptosis