rs2157056 chr3:46324292 G>A
- Sequence
gaagtcaaataaaatatatacaag[G/A]agaaggattctgggagacagagtt
- ASB in cell types
- macrophages form periferal blood monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 2.02 | -0.58 | 2.00 | |||
| monocyte-derived dendritic cells | 1.79 | 0.33 | 1.25 |
Items per page:
1 – 2 of 2