rs2158114 chr17:36131552 C>T
- Sequence
tgcaatttctccaagatatggctg[C/T]agttggataacttccctccctacg
- ASB in cell types
- HEK293 (embryonic kidney) MS-1 (Small cell lung carcinoma) monocyte-derived macrophages from peripheral blood CD14+ monocytes
- ASB for transcription factors
- CTCF_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.41 | 1.62 | 1.41 | n/a | No Hit | |||
| STAT1_HUMAN | -1.54 | 2.49 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, systolic blood pressure (sbp), triglycerides change with statins, urinary albumin-to-creatinine ratio