rs2158839 chr7:107854646 C>T
- Sequence
gtgtttgtgttggctctaaacaaa[C/T]cagttcttgcaatcctggccagtt
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.95 | -3.85 | 2.00 | -0.94 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP age at death with kuru exposure, longstanding arthritis, major depressive disorder, schizophrenia, triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid