rs2159637 chr18:9838352 A>G
- Sequence
actctgagccaaaacccatagtca[A/G]gacgcctgagtgtactcaggcaga
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.53 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP eye color, late onset alzheimers disease, resistance to kuru in aged women despite likely exposure, sporadic creutzfeldt-jakob disease