rs2161305 chr5:128769814 T>A
- Sequence
tgggacattttcagaaaggtgaca[T/A]ttggtttatacctgataatgttaa
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | -2.66 | 2.24 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diabetic nephropathy in type 2 diabetes mellitus - end stage renal disease, end-stage renal disease (all cause), end-stage renal disease (non-type 2 diabetes mellitus), hdl cholesterol, hdl cholesterol change with statins, height, salmonella-induced pyroptosis, total cholesterol, type 2 diabetes, type 2 diabetes with or without end stage renal disease, type 2 diabetes, end stage renal disease