rs2161514 chr5:107557532 A>G
- Sequence
ggtaaaagctatttttgtttcctc[A/G]tgtctaaacaatgacatttgtcaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MDA-MB-231 (breast adenocarcinoma)
- ASB for transcription factors
- ESR1_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.05 | 0.12 | 2.43 | n/a | No Hit | |||
| BRD4_HUMAN | 2.11 | 0.33 | 1.89 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, body mass index (bmi), diastolic blood pressure (dbp), ldl cholesterol, simpson-angus scale, total cholesterol