rs216154 chr16:15822132 T>C
- Sequence
ggcacttatacctgagtccctcta[T/C]cttgggggcggggtcgtggcatct
- ASB in cell types
- LUHMES (lund human mesencephalic cells)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.42 | -0.27 | 1.08 | n/a | n/a |
Items per page:
1 – 1 of 1