rs2163039 chr1:208388008 T>C
- Sequence
gagctgcaagactgacagttttat[T/C]gcagcacagtgggctctcttctga
- ASB in cell types
- HEK293T (embryonic kidney)
- ASB for transcription factors
- PKNX1_HUMAN SP7_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | 3.19 | -2.88 | 1.00 | n/a | No Hit | |||
| SP7_HUMAN | 2.01 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, ldl cholesterol, ldl cholesterol change with statins, premature ovarian failure, spine bone mineral density (bmd)