rs216334 chr12:6038445 C>T
- Sequence
cccctcacccttgggcaggccggg[C/T]tgggggctcccaggcctcttggtc
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) GM12878 (female B-cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines) LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | -3.78 | 4.16 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -3.95 | 3.27 | 3.50 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 0.99 | -0.99 | 1.00 | |||
| LUHMES (lund human mesencephalic cells) | -1.76 | 1.79 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP birth weight, ldl cholesterol, mitral annular calcium, salmonella-induced pyroptosis, venous thrombosis