rs2165634 chr17:75667217 T>G
- Sequence
gcagtgatgacgtagcgcgagcgc[T/G]ggcatgagggcggagccaggcgca
- ASB in cell types
- K562 (myelogenous leukemia) SK-N-SH (neuroblastoma) WA01 (H1, human embryonic stem cells) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- MEF2B_HUMAN EMSY_HUMAN RFOX2_HUMAN SUMO2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 3.41 | n/a | 1.50 | n/a | No Hit | |||
| EMSY_HUMAN | 0.52 | n/a | 2.00 | n/a | n/a | |||
| RFOX2_HUMAN | 2.46 | -1.50 | 2.00 | n/a | n/a | |||
| SUMO2_HUMAN | 2.60 | -0.58 | 1.80 | n/a | n/a | |||
| CREM_HUMAN | 2.55 | -1.65 | 1.83 | n/a | No Hit |
Items per page:
1 – 5 of 10
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood