rs216594 chr16:53009 A>T
- Sequence
tgcaaaggccctgctagcaccatg[A/T]gcacgatgagagatcgtccaggag
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) HepG2 (hepatoblastoma)
- ASB for transcription factors
- MNT_HUMAN FOXK2_HUMAN ERR1_HUMAN MAX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | -1.49 | 2.44 | 1.67 | 3.13 | Concordant | |||
| FOXK2_HUMAN | -0.91 | 2.45 | 1.62 | n/a | No Hit | |||
| ERR1_HUMAN | -0.02 | 1.83 | 1.62 | n/a | No Hit | |||
| MAX_HUMAN | -0.18 | 1.49 | 1.25 | 5.07 | Concordant | |||
| TIF1B_HUMAN | -2.15 | 2.95 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood