rs2166586 chr13:74892403 G>C
- Sequence
agggactaaaatgaaaccaaatct[G/C]tacaaaatacctaggttgggccaa
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.18 | -1.02 | 2.00 | -2.92 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP birth weight, ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1), total cholesterol, triglycerides