rs2166869 chr8:140950479 T>C
- Sequence
agctgcccaccccgctacagcagc[T/C]ggctgtgcaaggtggctggaccac
- ASB in cell types
- G523NS (glioblastoma) SU-DHL-2 (anaplastic large cell lymphoma)
- ASB for transcription factors
- ASCL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ASCL1_HUMAN | 1.71 | -1.71 | 1.00 | -3.76 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis