rs2167065 chr8:75648219 C>T
- Sequence
ataaacaattggaactaggggtac[C/T]ttagcatttcttagaatcccttca
- ASB in cell types
- KMS-11 (Plasma cell myeloma)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.03 | 0.20 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP antidepressant drug treatment outcome in depression, body mass index (bmi), hdl cholesterol, serum creatinine, serum urate