rs2167422 chr19:51661130 T>G
- Sequence
acttcatttctcacggtggatccc[T/G]ctcaagcagagtccgggagccaat
- ASB in cell types
- erythroid cells upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | n/a | 2.42 | 2.00 | |||
| upper lobe of left lung | -3.54 | 2.22 | 1.33 |
Items per page:
1 – 2 of 2