rs2167423 chr19:51661158 C>T
- Sequence
aagcagagtccgggagccaatcca[C/T]gtccaattgtgccccctgctggac
- ASB in cell types
- erythroid cells upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | n/a | 2.64 | 2.00 | |||
| upper lobe of left lung | -3.87 | 2.58 | 1.33 |
Items per page:
1 – 2 of 2