rs2169830 chr15:39579855 T>C
- Sequence
cggagcgagcccgatagcgctgga[T/C]cacagcagagggagcgaggcggct
- ASB in cell types
- sigmoid colon HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| sigmoid colon | 2.28 | -1.98 | 1.00 | |||
| HUES64 (embryonic stem cells) | 2.11 | -0.26 | 1.00 |
Items per page:
1 – 2 of 2