rs2170847 chr16:85422983 T>A
- Sequence
ctaatattgaacttgcctggcttt[T/A]aaatagcacctgtaaacaccacta
- ASB in cell types
- CyT49-derived endodermal cells HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CyT49-derived endodermal cells | 1.82 | 0.10 | 1.00 | |||
| HepG2 (hepatoblastoma) | 0.25 | 0.66 | 1.99 |
Items per page:
1 – 2 of 2