rs217259 chr5:138077274 T>C
- Sequence
caacaaaagagcctgttgtactat[T/C]cactgccagcagatggcaggcctt
- ASB in cell types
- neutrophils from periferal blood K562 (myelogenous leukemia) KMS-11 (Plasma cell myeloma) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | -2.04 | 2.64 | 1.50 | |||
| K562 (myelogenous leukemia) | 0.01 | 0.78 | 2.00 | |||
| KMS-11 (Plasma cell myeloma) | -3.02 | 1.37 | 2.00 | |||
| glioblastoma cells | n/a | 0.71 | 1.33 | |||
| CD34+ hematopoietic stem cells | 2.33 | -4.79 | 2.00 |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GRASP asthma, mitral annular calcium, partial epilepsy, resistance to kuru in aged women despite likely exposure
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood