rs218077 chr7:15042814 A>C
- Sequence
atctggttgtgaagtaaaagacca[A/C]gtattttctaagcagaggaaatag
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells-derived proerythroblasts | -1.01 | 1.72 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, fasting insulin, homa-b, obesity with early age of onset (age >2), partial epilepsy