rs2193 chr11:3849569 A>G
- Sequence
ggtaaccagaaactctgcggtgtg[A/G]agaaaggacagttatgctgctgta
- ASB in cell types
- glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | -3.41 | 1.86 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, ldl cholesterol change with statins, neuroblastoma (brain cancer), total cholesterol change with statins, variant creutzfeldt-jakob disease