rs219778 chr21:36462343 A>G
- Sequence
gagattgtcagctgatgccggggc[A/G]ggaatttccaaggtcacagctcct
- ASB in cell types
- BEAS-2B (bronchial epithelium) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.12 | 1.13 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), alzheimers disease, birth weight, diastolic blood pressure (dbp), hip bone mineral density (bmd), kidney stones, mitral annular calcium, partial epilepsy, serum creatinine, spine bone mineral density (bmd)