rs220133 chr21:42112388 T>C
- Sequence
tccccagctgttctgcacccccag[T/C]tgttctgcatctccccagttcttc
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TMD8 (diffuse large B-cell lymphoma) | 1.62 | n/a | 6.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Heart_Left_Ventricle, Lung, Pituitary, Prostate, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Whole_Blood