rs220719 chr6:46921173 G>T
- Sequence
acaaactcctttcccctcagtcct[G/T]tgtgggaggctgcagcctacattt
- ASB in cell types
- SUM159PT (Triple negative breast cancer)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SUM159PT (Triple negative breast cancer) | 0.02 | 2.37 | 1.00 |
Items per page:
1 – 1 of 1