rs223622 chr2:31805820 G>A
- Sequence
gtgtgtgcatgtgcctgtgtgtgc[G/A]cgtgtgtgtgcatgtgcctgtgtg
- ASB in cell types
- HT1080 (fibrosarcoma)
- ASB for transcription factors
- SSRP1_HUMAN MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SSRP1_HUMAN | -3.03 | 3.42 | 1.00 | n/a | n/a | |||
| MNT_HUMAN | -0.68 | 1.18 | 1.50 | 2.35 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), hdl cholesterol