rs224062 chr10:62743036 T>C
- Sequence
ctactgtccgcaaatcccactttt[T/C]ccagttattgacttcatccctttc
- ASB in cell types
- EOL-1 (Acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| EOL-1 (Acute myeloid leukemia) | 1.67 | -0.63 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, college completion, cystatin c in serum, height, ldl cholesterol change with statins, total cholesterol change with statins, triglycerides change with statins
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood