rs227627 chr20:24931471 T>C
- Sequence
agagagaatcctagcctggatcca[T/C]cacaaccgtgtaaaacctgcagcg
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines) GM10847 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | 2.44 | -3.85 | 1.33 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.64 | 1.66 | 1.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 1.53 | -0.99 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Liver, Lung, Muscle_Skeletal, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood