rs227859 chr14:22479482 C>T
- Sequence
acttaagtaaatatcaaggggagt[C/T]tgggcaactgagtttttgtagatc
- ASB in cell types
- primary B-CLL cells TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- BRD4_HUMAN SSXT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 2.22 | n/a | 4.00 | n/a | n/a | |||
| SSXT_HUMAN | 2.49 | -2.03 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, fasting blood glucose, neuroblastoma (brain cancer), partial epilepsy