rs228259 chr17:38825661 T>G
- Sequence
acctaaggtggaccagactaggcc[T/G]cctcccctcaccctgcacacaccc
- ASB in cell types
- HCT-116 (colon carcinoma) adult erythroblasts GM12878 (female B-cells lymphoblastoid cell line) CD14+ monocytes
- ASB for transcription factors
- ENL_HUMAN BRD4_HUMAN HCFC1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ENL_HUMAN | 1.13 | n/a | 1.50 | n/a | n/a | |||
| BRD4_HUMAN | 1.27 | 0.06 | 1.48 | n/a | n/a | |||
| HCFC1_HUMAN | 2.72 | -4.94 | 2.00 | n/a | n/a | |||
| STAT1_HUMAN | 1.78 | -0.07 | 1.50 | n/a | No Hit | |||
| PEX2_HUMAN | 2.27 | -2.27 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood