rs228590 chr11:108225414 A>G
- Sequence
gtcagaagaaccaccagtgaatat[A/G]aaaggagaagagaatcagagccat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia) MDM(monocyte derived macrophages) germinal center B-cells
- ASB for transcription factors
- MEF2B_HUMAN SPI1_HUMAN FOXK2_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | -1.16 | 2.79 | 1.50 | -3.17 | Discordant | |||
| SPI1_HUMAN | 0.62 | 1.76 | 1.57 | n/a | No Hit | |||
| FOXK2_HUMAN | -2.61 | 2.60 | 1.50 | n/a | No Hit | |||
| EP300_HUMAN | n/a | 2.08 | 1.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood