rs2286576 chr12:4604842 T>G
- Sequence
cgggggcgcagtctaactgagaag[T/G]tgtcctgggggagagcgttctgga
- ASB in cell types
- VCaP (prostate carcinoma) HMEC (human mammary epithelial cells) GM12865 (female B-cells) HBMEC (human brain microvascular endothelial cells)
- ASB for transcription factors
- ZN580_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN580_HUMAN | -1.57 | 2.36 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1