rs2306329 chr15:50908642 A>C
- Sequence
gcgagaacgacgctgaacttgttc[A/C]ggtgggacgccaataaagatttct
- ASB in cell types
- MDM(monocyte derived macrophages) foreskin keratinocyte CD14+ monocytes GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN STAG1_HUMAN SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.38 | 1.53 | 1.74 | n/a | No Hit | |||
| STAT1_HUMAN | 3.10 | n/a | 3.00 | n/a | No Hit | |||
| STAG1_HUMAN | 0.56 | 0.99 | 1.00 | n/a | n/a | |||
| SNAI2_HUMAN | 1.40 | -3.07 | 1.50 | n/a | No Hit | |||
| ETV4_HUMAN | n/a | 2.40 | 1.00 | 4.13 | Concordant |
Items per page:
1 – 5 of 7
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood