rs2352834 chr1:147892891 A>G
- Sequence
tttcaccagctggctgtgctgatc[A/G]tgccatctagtggtaggagtgcag
- ASB in cell types
- GBM39 (Human brain tumor) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GBM39 (Human brain tumor) | 0.13 | 1.49 | 2.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.19 | 1.04 | 1.11 |
Items per page:
1 – 2 of 2