rs2353318 chr2:51297678 C>G
- Sequence
ccaagtacaaatagtgaaacatgt[C/G]ttctagatcacatgtttgtatcct
- ASB for transcription factors
- RAD51_HUMAN BHE40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD51_HUMAN | -2.25 | 2.63 | 1.00 | n/a | n/a | |||
| BHE40_HUMAN | -2.12 | 2.28 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), college completion, diastolic blood pressure (dbp), infant head circumference, ldl cholesterol, years of education