rs2353679 chr19:39440536 T>C
- Sequence
gagacagggtcttgctctgtcccc[T/C]acgctggagtgcagtggcacaatc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia) HEK293 (embryonic kidney) tibial nerve
- ASB for transcription factors
- CTCF_HUMAN MNT_HUMAN ELF1_HUMAN ARI1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.12 | 1.76 | 2.02 | n/a | No Hit | |||
| MNT_HUMAN | -1.22 | 1.81 | 1.75 | n/a | No Hit | |||
| ELF1_HUMAN | -2.41 | 2.65 | 1.00 | n/a | No Hit | |||
| ARI1B_HUMAN | -5.01 | 2.92 | 2.00 | n/a | n/a | |||
| IKZF2_HUMAN | -0.94 | 1.85 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 8
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood