rs2358944 chr12:65723778 G>A
- Sequence
aacagatggaaatgtcaacagata[G/A]gaaggattggaaacaagaggttaa
- ASB in cell types
- VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -0.03 | 1.02 | 1.44 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, body mass index (bmi), college completion, diabetic nephropathy in type 2 diabetes mellitus - end stage renal disease, end-stage renal disease (all cause), triglycerides change with statins, type 2 diabetes, end stage renal disease
PheWAS acute cystitis, acute renal failure, alcoholic liver damage, anomalies of tooth position/malocclusion, anticoagulants causing adverse effects, back pain, bacterial infection nos, celiac disease, celiac or tropical sprue, cellulitis and abscess of face, chorioretinal scars, chronic prostatitis, circumscribed scleroderma, cirrhosis of liver without mention of alcohol, complications of gastrostomy, colostomy and enterostomy, deep vein thrombosis, deficiency of humoral immunity, dermatomycoses, diabetes mellitus, diseases of spleen, disorders of fluid, electrolyte, and acid-base balance, disturbance of salivary secretion, drug-resistant infection, electrolyte imbalance, esophageal bleeding, first degree av block, gram negative septicemia, hemorrhage of gastrointestinal tract, hypertrophy of female genital organs, hyposmolality and/or hyponatremia, impaired fasting glucose, iron deficiency anemias nos, liver abscess and sequelae of chronic liver disease, loss of teeth or edentulism, lung disease due to external agents, male infertility and abnormal spermatozoa, myoclonus, nerve plexus lesions, nerve root and plexus disorders, open wound of eye or eyelid, open wound of hand except finger(s), osteitis deformans and osteopathies associated with other disorders, osteoarthrosis, osteoarthrosis, generalized, other conditions of brain, other diseases of the teeth and supporting structures, other disorders of adrenal glands, other local infections of skin and subcutaneous tissue, palpitations, pneumoconiosis, portal hypertension, precordial pain, scar conditions and fibrosis of skin, staphylococcus infections, streptococcus infection, type 1 diabetes, type 1 diabetic ketoacidosis, type 2 diabetes, type 2 diabetic retinopathy, unspecified local infection of skin and subcutaneous tissue