rs2359470 chr12:4849196 C>A
- Sequence
tccctaagaacatgctgtaggtgg[C/A]gccatagagcagtccagggagaaa
- ASB in cell types
- WA09 (embryonic stem cells) 2588 (Lymphoblastoid Cell Lines) glioblastoma cells GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.14 | 0.34 | 1.28 | -2.55 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
