rs2360009 chr1:112881233 T>C
- Sequence
cctgtgtacccatacactggtccc[T/C]ctctccaggtttctttctttcttt
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) vagina
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 1.25 | -1.25 | 1.00 | |||
| vagina | 2.12 | -1.78 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Liver, Lung, Muscle_Skeletal, Pancreas, Pituitary, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid