rs2364624 chr19:23687021 T>G
- Sequence
ccccctctcgggatgtcgcacccg[T/G]aactctcaccatttctaggcttcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- CDK9_HUMAN MAON_HUMAN RBBP5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK9_HUMAN | 1.71 | -0.42 | 1.00 | n/a | n/a | |||
| MAON_HUMAN | 1.73 | -0.43 | 1.00 | n/a | n/a | |||
| RBBP5_HUMAN | n/a | 2.63 | 2.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol change with statins, simpson-angus scale, triglycerides change with statins
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Vagina, Whole_Blood